Nuestro arcón de ciencias

Un lugar donde los profesores os colgaremos información, pautas para trabajos, os recomendaremos videos y enlaces interesantes, ejercicios interactivos, juegos...

Un lugar abierto a vuestra imaginación y creatividad, donde incluiremos todo aquello que nos sugiráis.

Entre todos conseguiremos que nuestro arcón de ciencias sea un espacio útil, dinámico y atractivo.

¡¡Contamos contigo!!

domingo, 7 de mayo de 2017

Problemas de genética


        En este enlace podéis descargaros e imprimir (si tenéis el correo del colegio) los enunciados de los problemas que vamos a ir haciendo y corrigiendo en clase

   Problemas de genética

Para los que  no contáis con correo del cole, podéis acceder a ellos en la página "Apuntes y ejercicios 4º ESO" (en una pestaña en la parte superior del blog).

           Por cierto, no he podido resistirme a recomendaros esta animación es graciosa, ingeniosa y en inglés

 Cómo los guisantes de Mendel nos ayudan a entender la genética  

                                            ¡Espero que os guste!

Ejercicios de transcripción y traducción


      Este es el enlace de la actividad interactiva que hemos resuelto en clase por si quisiérais hacerla

                 Para que practiques, te sugiero algunos ejercicios:

1.La secuencia de bases de un ARNm es 5´AUGCCCGGGAUCGCUCUCUAG 3´
a) ¿Cuántos codones presenta?
b) Utilizando el código genético, determina la secuencia de la proteína que se sintetizará a partir de la secuencia dada.
c) ¿Cuál será la secuencia de bases de la cadena de ADN de la que procede la molécula deARN dada?

2. La cadena 3´-5´de un ADN es CTCGTAAGTCTGGCAATGCCTTTATC:
a) ¿Cuál será la secuencia de la molécula de ADN completa?
b) Transcribe la secuencia dada
c)  Representa los ARNt que intervienen en traducción, concretando los anticodones de cada uno y los aminoácidos que unen.
d) ¿Cuál será la secuencia de aminoácidos de la proteína obtenida?

3. La secuencia de aminoácidos de una proteína es Ser- Thr- Gly - Glu- Trp- Arg.
a) ¿Cuál será la secuencia de bases del ARNm que la codifica?
b) Si tras el codón que codifica a Thr  introdujéramos una A ¿qué ocurriría?


Si quieres imprimirlos accede a este enlace:


Clonando a Mimi

       Si tienes algún problema para comprender la técnica de clonación, aquí tienes un enlace que te permite trabajar en un laboratorio virtual y clonar a un ratoncito.


         En este otro enlace se te plantean diversos escenarios para que valores si se trata o no de una clonación. Una buena forma de aprender las características de los individuos clonados.


        Estas actividades te van a dar la ocasión, también, de practicar con el inglés.

miércoles, 1 de marzo de 2017

Flipped lab: disección de un corazón de mamífero



Dentro de unos días diseccionaremos un corazón de cordero o cerdo y aquí os dejo  un vídeo que os servirá para preparar  vuestra experiencia en el laboratorio.


Por si tuvierais algún problema, esta es la URL del vídeo:


Vedlo con atención, tantas veces como necesitéis y no olvidéis tomar notas para que os sirvan de guía durante la disección.
Recordad preparar un guión de disección y por si os sirve de ayuda, revisad este documento:

https://www.dropbox.com/s/hkxgd90o2s5tm7h/flipped%20lab.%20Diseccion-de-coraz%C3%B3n-%20Doc%20al.docx?dl=0

Las dudas que tengáis las resolveremos en clase, antes de subir al laboratorio.
Preparad e id completando la "V de Gowin".

jueves, 22 de diciembre de 2016

¡Vamos a repasar la primera evaluación! 4º ESO


Tal y como os prometí, aquí tenéis el enlace a la actividad interactiva que os indico en el PTI.
 La página tiene también información que os puede venir bien.
 ¡Ánimo, ponedle empeño y sin daros cuenta la evaluación estará superada!

http://e-ducativa.catedu.es/44700165/aula/archivos/repositorio/2500/2623/html/3_lmites_de_placas.html


miércoles, 2 de noviembre de 2016

Pirámides alimentarias

Uno de los desempeños contenidos en nuestro Proyecto de comprensión es la construcción de  maquetas/ carteles  de pirámides alimentarias  o ruedas de alimentos.  Por supuesto nuestras pirámides alimentarias van a estar actualizadas.

Para facilitaros la tarea de documentación, os recomiendo utilizar estas infografías:

Modificaciones 2016 de la pirámide alimentaria

Esta nueva pirámide alimentaria modifica en muchos aspectos a la que el SENC publica en 2011 (Pirámide NAOS) y que hemos comentado en clase. Por si os viene bien, aquí tenéis el enlace a la infografía que conocéis:

Infografía menú equilibrado: pirámide nutricional

En el siguiente enlace puedes encontrar explicaciones sobre las modificaciones que te vendrán bien

.Nueva pirámide de la alimentación saludable

martes, 18 de octubre de 2016

Identificando tejidos

El pasado viernes estuvimos en el laboratorio para identificar tejidos presentes en un muslo de pollo. Fue fabuloso veros manipular, usar tijeras y bisturí en busca de tejidos. Decir que vuestro interés, esmero y curiosidad supero mis expectativas y, por ello, una vez más me hicisteis disfrutar.
Seguiremos compartiendo muchos ratos así, os lo prometo.

Aquí os dejo algunas de las fotos que hice mientras investigabais para que las podáis usar en los informes que estáis preparando. No olvidéis señalar los tejidos identificados y tened en cuenta que la creatividad es un plus,,,




¡Estoy impaciente por ver vuestros informes!








martes, 4 de octubre de 2016

Viaje al centro de la Tierra

Aquí tenéis los enlaces para acceder a la información que necesitáis para completar el cuadro comparativo de los modelos geoquímico y dinámico:

http://nea.educastur.princast.es/repositorio/RECURSO_ZIP/1_jantoniozu_La%20geosfera_v_NEA/La%20geosfera_v_NEA/flash/ESTRUCTURA.swf




sábado, 1 de octubre de 2016

Sorprendentes células humanas


Para afianzar el conocimiento de las células humanas, como bien sabéis, células eucariotas animales, os propuse hacer una célula en pestañas y he de confesar que vuestra creatividad me ha sorprendido muy gratamente.
Para agradeceros vuestro interés y trabajo he decidido publicar esta entrada. Espero que os guste....


¡Gracias, chicos de 3º ESO!

Veo, veo...  ¿qué orgánulos ves en estas micrografías?


martes, 20 de septiembre de 2016

Me gusta, no me gusta....

Ya hace algunos días que iniciamos un nuevo curso,  un nuevo viaje y quise saber que cosas os gusta hacer en clase y cuales no.
En unos carteles, fuisteis anotando los desempeños que más os habían gustado y los que menos el curso anterior y eso me ha dado muchas claves para diseñar clases en las que aprendáis Biología del modo más grato posible.  He descubierto,con gran emoción, que compartimos muchos gustos.
Para no olvidarlo incluyo algunas fotos de los carteles que han quedado expuestos en clase, a la espera de que con el avance del curso vayáis  añadiendo nuevas rutinas, desempeños y proyectos que vayamos llevando a cabo.

¡Con vuestra ayuda nuestra singladura va a estar cargada de sorpresas y buenos momentos!








domingo, 18 de septiembre de 2016

¡Bienvenidos a bordo!


Hace unos días iniciamos un nuevo curso, un nuevo viaje. La ruta está diseñada pero, a buen seguro, nos esperan sorpresas, situaciones inesperadas y, por supuesto, muchos buenos momentos.
Como testigo de todo ello este cuaderno de bitácora, este diario de viaje que hoy reestrenamos. 

En esta primera entrada queremos dedicaros unas palabras que Jorge Laborda escribe en su libro “El embudo de la inteligencia y otros ensayos científicos”:
“PARA MÍ. La ciencia supone una cima desde donde ver el universo y la vida con una perspectiva única y maravillosa. (…)
Le aseguro sin ninguna duda que si hace un poco de esfuerzo, si estimula su curiosidad, si se pregunta por qué, si se pregunta cómo se sabe, si aprende, en suma, a ser algo más científico en su vida, la recompensa será mucha”.

Esperamos ayudaros a encontrar respuestas pero, sobre todo generar muchas, muchas preguntas… De ser así conseguiréis ser un poco más científicos, un poco más humanos.

¡Bienvenidos a bordo y feliz travesía!



lunes, 29 de febrero de 2016

¿Tendrá alguna mutación genómica?

Para trabajar con cariotipos y elaborar idiogramas imprime los siguientes documentos:

domingo, 29 de noviembre de 2015

Repaso del tema de Invertebrados

Atendiendo a  vuestra petición aquí tenéis los indicadores que debéis tener en cuenta para repasar bien el ejercicio del día 1 de diciembre.
¡Espero que os sea útil!
     
  • Conocer e identificar las características de los animales.
  • Exponer las características propias de los animales invertebrados.
  • Poríferos
  • Diferenciar a los poríferos del resto de invertebrados.
  • Conocer las características corporales que diferencian a los poríferos.
  • Describir las funciones vitales de los poríferos.
  • Relaciona la presencia de determinadas estructuras en los poríferos con su adaptación al medio.
  • Cnidarios
  • Diferenciar a los cnidarios del resto de invertebrados.
  • Reconocer las características corporales que diferencian a los cnidarios.
  • Describir las funciones vitales de los poríferos.
  • Clasificar cnidarios según sus características.
  • Anélidos
  • Reconocer las características corporales que diferencian a los anélidos
  • Describir las funciones vitales de los anélidos
  • Moluscos     
  • Diferenciar a los moluscos del resto de invertebrados.
  • Conocer e identificar las características corporales que diferencian a los moluscos.
  • Describir las funciones vitales de los moluscos.
  • Clasificar moluscos en diferentes grupos según sus características.
  • Artrópodos
  • Diferenciar a los artrópodos del resto de invertebrados.
  • Conocer e identificar las características corporales que diferencian a los artrópodos.
  • Describir las funciones vitales de los artrópodos.
  •  
  • Definir con claridad las estructuras y funciones vitales propias de cada grupo de invertebrados.
  • Elaborar y completar tablas comparativas
  • Utilizar de forma adecuada y correcta el vocabulario científico
  •  

lunes, 16 de noviembre de 2015

Videoquest: "Esponjas: el origen de la vida"

Os dejo el enlace para que veáis el vídeo sobre las esponjas que os dije en clase:


Y estas son las cuestiones a las que tenéis que responder:

1.    Según el vídeo, ¿cuál es el primer animal originado evolutivamente? 
2.    Enumera tres características de los poríferos de las que se hable en el vídeo.
3.    Al cortar un fragmento de esponja de mar como aparece en el vídeo, ¿estamos haciéndole daño? ¿Por qué? Razona tu respuesta.
4.    Las esponjas, como animales que son, son pluricelulares. Pero, según el vídeo, ¿sus células están tan relacionadas como las del resto de animales?
5.    ¿Qué ocurre si pasamos una esponja por un colador?

Añadid en la tabla que hemos hecho en clase las características que hayáis descubierto con el vídeo.



domingo, 15 de noviembre de 2015

Representación de Modelos de la Estructura de la Tierra.


En clase hemos visto los modelos que explican la estructura interna de nuestra Tierra y para ayudaros a comprenderlos, diferenciarlos facilmente y estudiarlos, los puedes representar.

Sigue las instrucciones que te marco y las pistas...

Instrucciones

Þ           Utiliza un folio en blanco.
Þ           Dibuja una pirámide invertida grande, dejando hueco alrededor para hacer anotaciones.
Þ           Divídela longitudinalmente por la mitad. A la izda representa el modelo geoquímico y a la dcha el dinámico.
Þ           Aquí tienes los datos que necesitas y ten en cuenta, también, lo que hemos visto en el tema:

·                     Modelo geoquímico

F Las discontinuidades se sitúan a 75, 2900 y 5100 Km respectivamente.
F La Corteza tiene un espesor de unos 75 Km.
F El Manto superior se extiende hasta los 670 Km.

·                     Modelo dinámico

F La Litosfera tiene un espesor de unos 100 Km.
F La Astenosfera tiene un espesor de unos 150 Km.
F La Mesosfera superior se extiende hasta los mismos Km que el Manto superior.
F La Endosfera superior e inferior se corresponden con los núcleos externo e interno.

Ahora, junto a cada geosfera  anota sus características.

¡Fíjate en tu gráfico y responde! 
  •    ¿Qué capas del modelo geoquímico ocupa la litosfera?
  •     ¿Y la Astenosfera?
¡Te has preparado un 
valiosísimo material de estudio!

Aquí tenéis un gráfico que tal vez os venga bien:








lunes, 2 de noviembre de 2015

¡Una ayudita para repasar el examen del Tema 1 para mis chicos de 1º ESO!

Aquí tenéis los estándares indicadores de evaluación que se contemplan en el examen del Tema 1: Los seres vivos.
 Podéis usarlos para repasar el tema e incluso para autoevaluaros...
  1. Determina las características que diferencian a los seres vivos de la materia inerte.
  2. Define célula.
  3. Identifica los tipos de células justificando su respuesta.
  4. Identifica los elementos celulares estudiados en clase y conoce su función.
  5. Define y diferencia nutrición autótrofa y heterótrofa.
  6. Explica y diferencia las funciones vitales. Señala características de estas en animales y plantas.
  7. Define especie y aplica la nomenclatura binomial.
  8. Conoce los diferentes taxones y los relaciona.
  9. Caracteriza los reinos y clasifica organismos comunes
  10. Utiliza claves dicotómicas sencillas.
  11. Usa adecuadamente el vocabulario científico y se expresa correctamente.
  12. Elabora mapas conceptuales.

domingo, 1 de noviembre de 2015

¡Buscando yacimientos geológicos!

 Te sugiero una actividad interactiva en la que debes asumir el papel de técnico en geología y buscar distintos yacimientos de interés en una isla, la Isla de las Ciencias.

           Accede a este enlace, lee con atención y haz lo que se te pide.



           Bajo el encabezado, a la izquierda, aparece "descargas", si haces click, podrás acceder a un formato rtf, en el que responder a las cuestiones que se te plantean y elaborar el informe que como técnico especializado se te ha solicitado.
Una vez completo deberás entregarlo a tu profesora.

jueves, 1 de octubre de 2015

                                    ¿SABÍAS QUE...?

No hace mucho,los alumnos de 1º ESO realizamos una visita al Museo Provincial,allí aprendimos muchas cosas diferentes sobre insectos. Una de ellas fue quelos mosquitos pueden contagiar enfermedades...
 ¿Os gustaría aprender sobre uno de ellos? Pues continuemos.


miércoles, 13 de mayo de 2015

Preguntas para el Examen sobre el Sistema Solar





En este enlace puedes descargar e imprimir el documento con las preguntas y respuestas sobre el Sistema Solar que tenéis que estudiar.

Todas las cuestiones han salido en vuestras exposiciones en las que habéis mostrado que os habéis convertido en unos verdaderos expertos.

                                              PREGUNTAS SISTEMA SOLAR

Si tenéis dificultades para acceder al documento  podéis encontrar las preguntas y sus respuestas en la pestaña superior "Preguntas Sistema Solar"


   
                     

martes, 12 de mayo de 2015

¿Juegas a hacer transfusiones sanguíneas?


Lo prometido es deuda.
¿Te apetece jugar a médicos y  realizar transfusiones sanguíneas a algunos pacientes?



Seguro que lo has hecho muy bien y tus pacientes pronto volverán a casa...

miércoles, 29 de abril de 2015

¡Hoy soy el profe!: Sistema solar



Dicen, y la experiencia me hace estar de acuerdo, que una buena forma de aprender es enseñar a otros.
Por eso, vuestra idea de ser profesores por un día me atrajo mucho...
Nos permitirá aunar varias cosas que os gustan: el tema del Sistema Solar, investigar, trabajar en equipo y explicar lo trabajado a vuestros compañeros.
Os confieso que se parece mucho, mucho, al trabajo de un profesor...

Para buscar las respuestas a las preguntas que os planteo en el tema que vais a trabajar os recomiendo estos recursos:


               Libro de texto

·          Interactivos para 1º ESO:

Ø  Proyecto Biosfera

Ø  El Universo y el sistema solar (recursos tic)

Ø  La Tierra en el Universo- libros vivos

·         Con buena información:

Ø  Definiciones, muy claro

Ø  Astromía

·         Interactivos y con muy buenas imágenes

Ø  Solar system scope

Ø  El nuevo sistema solar- el país

Ø  Surcando el cosmos. El mundo

Ø  Quién pone nombre a los cometas y meteoritos

Ø  NASA

·         Videos

Ø  Planetas

Ø  Tormentas Solares






domingo, 12 de abril de 2015

Historia de la vida


En clase, vamos a construir una línea del tiempo con los acontecimientos más importantes de la historia de la vida en nuestro planeta y este material os va a venir muy, muy bien...


Si hacéis click en "anterior", en la parte superior derecha de la página, podréis ver la animación del proceso de fosilización que os mostré en clase.

Para buscar información sobre los fósiles guías os sugiero estos enlaces:

                                                        FÓSILES GUÍAS

                                    LOS FÓSILES Y LA PALEONTOLOGÍA

El otro día comentábamos como la historia de la vida va ligada a la historia geológica de la Tierra y como sentíais mucha curiosidad por saber cómo ha ido cambiando la posición de los continentes (fenómeno que se conoce como Deriva continental),  os invito a ver este pequeño video:


lunes, 6 de abril de 2015

VÍDEOS DE GENÉTICA




Comenzamos el tercer trimestre estudiando Genética. Aquí tenéis unos vídeos que os van a ayudar a  recordar los ácidos nucleicos y a entender mejor lo que explicaremos en clases posteriores.








jueves, 19 de marzo de 2015

¡Vamos a repasar! Segunda Evaluación

Para ayudarte a preparar el examen, te invito a que resuelvas estos ejercicios con mucho, mucho esmero...
Tráelos hechos el día del examen. 

sábado, 14 de marzo de 2015

Replicación y transcripción

Entender estos procesos es más fácil de lo que parece. Ve estos videos y lo comprobarás...

viernes, 6 de marzo de 2015

¿Mitosis o Meiosis?



             Estas animaciones, del Proyecto Biosfera, representan dos procesos propios de las células eucariotas. Obsérvalos bien y después resuelve la actividad que se te propone en el enlace situado bajo las animaciones.   Sigue el modelo que se sugiere en la plantilla  pero no es necesario que la uses.


A


B
             

miércoles, 18 de febrero de 2015

UNA CLASE ACUÁTICA

¡Hola de nuevo querido lector! 
He preparado este cómic para representar con ayuda de Bruno nuestra clase, espero que os guste y que disfrutéis como lo hago yo en Ciencias Naturales, ya que no me podréis negar que es de las asignaturas más divertidas, al menos desde mi punto de vista. Y vosotros, ¿qué pensáis?

martes, 17 de febrero de 2015

LAS CÉLULAS EUCARIOTAS Y PROCARIOTAS


LAS CÉLULAS EUCARIOTAS Y PROCARIOTAS

Aquí tenéis un vídeo que puede ayudaros a ampliar vuestros conocimientos sobre las células eucariotas y procariotas. Espero que os guste.


miércoles, 11 de febrero de 2015

PABLITO VS C.NATURALES


Hace tiempo, Pablito pensaba que las clases de Ciencias Naturales no eran nada divertidas, pero....

Un día su profesora, Prado, le abrió las puertas a un mundo fascinante..


- Pablito, para mañana vas a buscar información sobre los mejillones. Si quieres hacerme un trabajo ¡excelente!.Te recomiendo que utilices nuestro arcón de ciencias
( www.arcondeciencias.blogsp ot.com.)

Pablito al llegar a casa se metió en la pagina web que le dijo la profesora y....


¡Hola chicos! Me llamo Pepe y formo parte del filum  Moluscos. Soy un mejillón, pero los científicos me llaman  Mytilus edulis. .Bueno, si queréis saber más sobre mi ,seguidme...




Lo primero es lo primero.
Tenéis que saber las partes de mi cuerpo y, para ello,  os propongo hacer este puzzle y cuando lo terminéis aparecerá una imagen mía y de algunas  partes de mi cuerpo.


Mejillón



Ahora que ya sabeis cómo soy, seguro que os preguntáis cómo me alimento, Lo hago mediante filtración, tomo sustancias nutritivas del agua del mar.
Ademas, os explicaré mi respiración y mi reproducción. Respiro mediante mis branquias y tengo fecundación externa, soy ovíparo y además unisexual.


Por si queréis visitarme os diré mi dirección: vivo tanto mar adentro como en las zonas de costa, manteniéndome alejado, sobre todo, de las estrellas de mar, puesto que soy su plato favorito.





                                                         
       

Eso es lo que pasa si me acerco a una estrella de mar, me come.




Pablito al llegar el día de la exposición de su trabajo estaba impaciente por enseñarle a su profesora todo lo que, gracias a Pepe,  había aprendido.

- Pablito tu trabajo sobre el mejillón me ha encantado. Espero que hayas disfrutado aprendiendo  y que, a partir de ahora, no te aburras en las clases de Ciencias Naturales.
Si, Prado, a partir de ahora seré uno de tus mejores alumnos.

martes, 3 de febrero de 2015

EL EFECTO INVERNADERO


Durante unos días, hemos  aprendido en clase cuales son las causas, las consecuencias y las posibles soluciones al efecto invernadero, uno de los principales problemas que tiene nuestro de medio ambiente.
Sabemos que las soluciones al cambio climático están en manos de los gobiernos pero que también nosotros, como ciudadanos de a pie, podemos contribuir con nuestras actitudes diarias a mejorar el medio ambiente.
Aquí tenéis un vídeo que os ayudará a comprender mejor el efecto invernadero, espero que os guste.